Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065H05
Clone ID D065H05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD065H05
Sequence
TTGCTGACATGTTACTGGGTACCAGGAGTAGGTTTCCCTGAAACAGAGGATGACTACGCACACTCATGGTCACTGTGGCA
TAGCATTAAATCTTTGATGTATTTGCTTTTGCTATAACATACCTGAAGCTGGGTTACATTATAAAAGAGTTTGCTTTGGC
TAATAGTTCTGCTGTCCCCTGTGTGGTAGTAAAATTGGAAGGGTAAATTGGTGTGTTTATACAGCGAGGATGGGGAGGTG
CCTTCTAACAGGTCTCTATTGTGAGAATTAATTTCCCCCCTCTGTATGTGTAATTGTGGAATCCCCAGGAGCCAGATACT
ACCACTAGGCTCCCCCCACCCCCTAATGCTGCCACATGCAGAAATTAAATCCCTAGCATGAGTTTTGGTGAACACTAATG
ACAGACACTCAAATTTAAGTTTCTAAACACTTGCCTGAATTTTGGCTTGAACTGGTCATTTCAAACCTCTGTGAGCTAAG
AGCTCTGTGAGCTAAGAGCGATGTTTCCTCCACGATATGCTAGATAAAAATCTGGGGGTGGGGGGTAACCAGAAGAGGGA
CAAAGCACCTTGTACTAATTGTTTAAATATTTAATAAAGGTCTCATCAGGAAACCTAATAGAGGTCTNNNCCCATTTTAA
TGGTTGTATGGGAAATCACGCCCTTTTAAGGGCAAAGATGGAAGCTTTTCCTCTGCTTACCAGAACTAACGTGTGTTCTA
ATCAGGTTTATATTTATAAAGGAAATGCCAACTTT
Sequence Type genomic DNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110367242..110367996 749
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]


SPLK-Sequence tag 3SD065H05
Sequence
AGGGCCACATCCAGAAACTTAGCAGGCAAAGGCTGCAAATACCCCTCACAGAAGGGAAGCCCAAAAATCGGTGTTAGGGG
GAAAGGGAGTAGACCACAGAAACAAGGTCCCTTCTTAGCCGGCTGGCTTGCTCAGGCAGTTGAGAACGCTGACATTCCGA
AATCAGCCAGTTAAGCTGTCCCGGGAGGCCGGTTTGTTAAGGGGAATTAGCGAATGTTGCCCCTACATCATAGATAGTCT
GGGATTTCACATCACATCAGACCATGTTTGGAGACTGTCCCCACATACCATGACAGTCACTGCAGAGAAGGGGACTTGAT
AGCGTTTTCTGTAGGCCTGACAAACCTGGCTGAGTGGGAACACCAACTGTTGGCGGGACTAGGGGCTTTGGGGGTTAGTG
AAGCGCACAGCAACTTACTTGGCAGCCATCTGGACATGTTTGTTGTGGTGACCGTGGGGGGTTCCAGGGCAGTTGTGCTA
GCCACAGAAAGCTACGTGAGCTGTAATTGGACTCTGTACATACAAATATGTTCCTTGCTTATGTACATTAAATGCTAAGA
ACTCAATGTCTTTGCACTGAATTAAACATACAGCAGAGAACTATAATGCAAGCTTTCCCGCTGAGTTTGTAAAAGGCTCA
TTAAGAGCTGGGTGTGGGAGAAGACTGTGTCTGTCTCTCCACTCCCATATTATTCCTGTGGGTTCTAGGGGCTTACTTTG
CATTGTACTCTGGTGACCTGTCTCTTCCACTGGATGCAA
Sequence Type genomic DNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110368025..110368783 759
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es