Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065H04
Clone ID D065H04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD065H04
Sequence
ACTTACACAGTTGCCCCCTGTCTGCTCAGCTCCTTACACTTCTGTCATTTTCAGTTTCTTGCGGATTTTTTATTTATGCA
AATATAAATGAGTTTTTACTTACCCCTCACATATACCATCTATATTGATTTCTGTATCTTTCTTTTTTCATTTAACAATA
CATCCTTATTTTGTGAAGACACCTGTACATTTATAGTTACTTGGTAGCATAAAGACTTAAACAAACCTCTAATAGCCTAT
GTGGTGACTTTTCAAAGAGCATACTTTTGACAGTTTCACTTAAGCTTATGTTTGTGATTTTAAATGCTTCTTGCCTAGAT
CAAAAGAGGNNNCCCTGTCTCTGTCTGTTCTCAGGC
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34933773..34934127 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


SPLK-Sequence tag 3SD065H04
Sequence
GTGTGCAGAACACTGAGCCATTCTCCCAGCATTCAGTCTTGGGCTCTTCTCAGTCCTTCAAGTCCTAGCTTTTACTTCAG
AGCTTTCTTTTGTCTTATTCTTCGCAACTAATTACTTCACAGTGTGGAACATTCAGACCTTTGATTCTTAACTTCTGGTA
GAGTCCCTGTGTACCTGTATACTTGCTGGATTTCTCAACTTAGTAGTGTCGACAGAAGAANNNTTCAGAGNNNNGACCAA
ATTTTTACTTAGCAACCTTCCCTTGTGGAATGTCCTTCAGAAAGTGTTTGGGAGTGGGGTGCAGTTCAGCAGAGGCGTAT
TGGCTGATTACCCTTGAAGACCTGTGGTGTTTGATTCTCAGCACCAAAGGGGAAGGAATGAGGCAGGGCAAATTTTGTTT
CAGGAAACAGTACATTTTGAAGGATTTTTATAATGTCAGCAAAACTATTACAGTAGTTGAGAAAGCCTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es