Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065G08
Clone ID D065G08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD065G08
Sequence
ACTGGTTAGGTGCAGACCATTGCCTGGCATCTGCAATCCTCACAGAGCCCCACTCAGCCAGTCACCAGCAAAGAAAGGTC
ATGGGCTAGAAGCAGATAATTACGCTGTCTCAGGAATTGAGGGTTTCCTCTGAGGACCTCACGAGTGCAATTCATTTCTT
CAGTCTTTCTTCCTCAGTATTATCAAAGTCAACAACAACAACAGCAAAGATTTTTCTTCCCCATCAGGACCCACCAGTGC
AGGATGCAGTGTCAGTATGAATTTTAATCAGGGTATCTTGTTTTTCAAGCCCCGAGTTTTTCCCTAATCAATTTCTTTTT
GTCTATTACCAAAAGCACATAGTTATAGAGTATGAGAACCAATCAATCCCAACACCTAGAATTCGATTGCTCACACTTTG
AGCTAAACTCCAGTGAATGTTTCTACAGAAGCCAATTTTATGCAAAAGGCATAGCCCAAGAGGGATTCTTTTTGTTTGTG
AAAGTGACTCACTCTCAGGTCTCTTGAAAAGGGTGAGCTGGCACAGTGGGTGTGTTTCCACCAAACATACTCCATTCTCC
TTTTCCATTTCCTTGTCCTTTATTTTACANNNACAG
Sequence Type genomic DNA
Unitrap ID UNI13974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25155990..25156584 586
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037492 (Zmat4) NM_177086 zinc finger, matrin type 4 Gene [Source:MGI (curated);Acc:Zmat4-001]

 
Come back to gene ENSMUSG00000037492


For any suggestions or comments, please send an email to unitrap@crg.es