Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065D06
Clone ID D065D06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD065D06
Sequence
CTGGAACTGCAGTTTATGACATCTATCAGCTGCTATGTGATTGCTGGGAACTGAACTCAGGTCTTTGAGAAGAGTGGTCA
GTGCTCTTAACCACTAACCATCTCTAAAGCCTCACAC
Sequence Type genomic DNA
Unitrap ID UNI16565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19825368..19825484 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052214 (Opa3) NM_207525 optic atrophy 3 (human) Gene [Source:MGI Symbol;Acc:MGI:2686271]


SPLK-Sequence tag 3SD065D06
Sequence
TTAGTGATAAAGTGTGCACTGAGGCCCTAGGTTCTGTGCTGGGGAGTGGGGGTGAGAGCAGCTGGCCAGGCGTGGAGAAG
CAAGCCTGTAAATGCAGCCCTTGAACTGC
Sequence Type genomic DNA
Unitrap ID UNI16565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19825557..19825665 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052214 (Opa3) NM_207525 optic atrophy 3 (human) Gene [Source:MGI Symbol;Acc:MGI:2686271]

 
Come back to gene ENSMUSG00000052214


For any suggestions or comments, please send an email to unitrap@crg.es