Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065C11
Clone ID D065C11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD065C11
Sequence
ACTGCCAAGGCCAGTGCCTGCTCCCTCTGTATTCTCTGGCTGCCCTCGCATTTCATCTTCTCTCATTTTCATCTGGTTTT
TCTGTATCATGTCTCTAATTTCATTCTTGTCTGTGTAGAAA
Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62239406..62239526 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


SPLK-Sequence tag 3SD065C11
Sequence
CCCTCTCATGATCTCTTGCTACTCCTGTAAAAGATTAGTTTATCATATGTGTTTGGCTTGTTTTGGGACTTTCTATCCCT
TTCTGGAAGTCTGTAAGTTTTTAGTTCAACACCATGTTTT
Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62239240..62239359 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es