Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065B10
Clone ID D065B10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD065B10
Sequence
CTTTGCAAAAGCCAAAATTCTTGGAACCCCAGGCCAGTGGGGCCCCCCCCCCCTTCTGCAGGGTTTCCTACTGCTGCAGA
GGAAGAGCCTGAACTCAGAGACACCACCTCCCTGCCTGGATAACTAGGGTAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD065B10
Sequence
GATTGTCGGAATACTGCCAGGTGTAAGTAAGCAACCGTAGGCCAGGCTTGTGTTCCAGTTTCAGAACCTTGAGGCAGGTT
CATTGACACTTGGAAGTGGTGCTCACCACCTGCCTGGCCAGACTAGGAGCGCACTGAATCACAAGAGCCCAGAAAGTCTT
TGCTGGGAAAGTTTCTTT
Sequence Type genomic DNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123057824..123058001 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es