Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065A12
Clone ID D065A12
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D065A12
Sequence
TTTTTTNNNCTCCNNNNCAACGCAAGCTTTTGGGAAGCCGCGAATTGTCAGCCAGAAGTGGATCGTTGTAGTCAGCCTTA
GTGGTTGAGGCAAGTGTGTGCTTCTGAGCTAAGGAATGGCCATGGTACAAAGATTTCTCTGGGGCCGTAAAGGATTTAGT
GACAAGAGAATTTAAGTCCTCACGAGCAGAAAGAAGTCGGGCGTGCGTTTGAAGCCCGATCTTCCGGGACCTGTGCTTTG
CACTTTCCTTCCAGACCCGGTGAAACTTCAGCCTGCGTAGGCTGAGGTCAGAAGTGCCCGCCAAGATGGAAGTGAATCCC
CCCAAACAGGAGCACCTGCTGGCGCTAAAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 104968194..104968527 326


SPLK-Sequence tag 5SD065A12
Sequence
GATCTCTGTGAACCAGCATAAATTTCAGCTGGCATTTGATATGTTTTTTTCAAAAATTGCTCCTAAATCTGTCCATGGCG
CAGGGATGAAGTTACCAGAATTTAACTTATCTGTAGATAGTGTAGCACGATAATACCAAGGATTTGAAATAAGTGGAACT
ACACCTAATACTTCTTAGATTTGTTGAAATATACTACAAATTAATTCATACTGTAGTATCATGTTTGTGGGAAAATTGAC
TAGACTATCTTAACAACTTTAACTGTCTATACGCAGAAGTTTTGAATACGTTTTAATGATTTAATTTGATCAGAAAAAAA
AAGATAAGAGGTCAGATTTTCCTTGAATTTGCTTATCGATAACCTTTTATTTAAAAACATTTTCAGCCTCTTTTTTATGT
TTGCTACTGCCACAATGCACTTTCTTGCTTTTGGGATGTGCATTTATAAAGTTAACAGTGACTTCAACTGATAGGGAGAA
ATGCTTACAAGACATTTAAACTAGATTGAATTGCACTTAACCTTCTTTAAGGCATCCCTTTTGATA
Sequence Type genomic DNA
Unitrap ID UNI29870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 104967436..104967981 544
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078936 (2410002O22Rik) RIKEN cDNA 2410002O22 gene Gene [Source:MGI Symbol;Acc:MGI:1914225]


SPLK-Sequence tag 3SD065A12
Sequence
ACACATCNNGCANNTCAGAAGCTCGCCAGTAANCAANNCTAACCTACAATCCTGTTTTGATGTCTGCAGTTAATATGACT
GTCTATGAATGTGGAACTAAGAAGGTTTGCAATATTTATCAATACAACAATGAGACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000078936


For any suggestions or comments, please send an email to unitrap@crg.es