Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D064A04
Clone ID D064A04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD064A04
Sequence
CAATGTGTTTGGACCTATTGTGTGTAACGGTATAGCACCTGTGTATGAGGGATATATCAGATAGCCAGTAATTATGCTTC
CAAGAGTGTTAATCAGAGGGGGACTGTGTGTATGTTTGTATACTATGTG
Sequence Type genomic DNA
Unitrap ID UNI15003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30693899..30694027 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058402 (Zfp420) zinc finger protein 420 Gene [Source:MGI (curated);Acc:Zfp420-001]


SPLK-Sequence tag 3SD064A04
Sequence
TGTGAGGAGTTTGAGTGTGATTATGTAACTTTATGTGATACCATGAGCATGGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI15003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30694045..30694102 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058402 (Zfp420) zinc finger protein 420 Gene [Source:MGI (curated);Acc:Zfp420-001]

 
Come back to gene ENSMUSG00000058402


For any suggestions or comments, please send an email to unitrap@crg.es