Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D063H07
Clone ID D063H07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD063H07
Sequence
TGATCATTCAGAATTGTTGGCGTTTTGCAGACTACTCCAACTTTGCACTAGTTTTGTTCTGAGTAGGGTTAAGTGAAATA
GTTGGGAGGCTATTGAAATTTGAATTTGAAGTTAGTAATAACTTTGGCCTTTGAGGTTTTCTAGAATATCAATCTTAAAA
AGTAGATGAAAGTCATTTTGTTTACATGCTTGTTAGCACACTTCATACTTTTAAGAGTTGAAATTGGTTGGCTAAATGTT
ATTTTTATTATAACGAGTCTGATGGGATTCTTTTGTAAATTTTAGAACCTCCTCTAGGTGGAGAGGAGCGGCAAGTCTTA
GTGAAGACTCAGTGTAAAATTAGGTGCTGTAGACAATGTGAATTTTACATCTGTGTGGACCATTCCTGCTCTTAGCTAAC
TGTGAAAAGGTGTGTTCACCTGTTAAGATAGTTAAAACACGCCTCAAGACTAAGTTTTTAAGAGGTTTATAGCAATCGAT
TTATGTAGTG
Sequence Type genomic DNA
Unitrap ID UNI30244

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 72815973..72816462 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027109 (Sp3) NM_001018042 trans-acting transcription factor 3 Gene [Source:MGI (curated);Acc:Sp3-002]


SPLK-Sequence tag 3SD063H07
Sequence
AAAAGTTAGCTGTTGTATACTAGTCATTCAACGTTGTTACTCTGTATTAGTAAATAGATATTTTTAGTCTGAAATTAGAC
TATGGACAGTGGGAGCATTTTTAATGTCATGTATTTTTTAAGCATATTAAAATATCAAAAGCTGTTTGGGAAAACTTTTA
AATTTAAAGAAACGTTAAGCAGATTAGTAAACTTTTAAAGTAAGTTATATTTCCCTAGTCCCAAAGTGTCAAATTAAGTT
TATTGTTTTCCTTAATAAACTACCTCAGAAGTAAAATTGAAAAATAAACTTTAAATAAAGTGCAATTTTTCATGTAACTA
TCAAAGTTTCAGAATGTGCTTACAGATGGGGAGGGGAGTGGTGAGGAGAAGCACAGGGTTGAAAGCATCATGCTTAGACT
CCAACTCTAGTGGATCACTAGACTGACCCCAGCCATGTGTTTGTGTCATGTTCTTGGGCTTCTTTAAGATC
Sequence Type genomic DNA
Unitrap ID UNI29513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 72815480..72815950 471
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079286 (AL844840.8)  

 
Come back to gene ENSMUSG00000079286


For any suggestions or comments, please send an email to unitrap@crg.es