Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D063H01
Clone ID D063H01
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D063H01
Sequence
GACCACTCAAAAATTCCCCTCTTCCCAACATTTCGGGAAAACAGAGAAAGAAGTGATAGGAGGGCTCTNNAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD063H01
Sequence
ACAAGATGGACATCCCAGGCTGCCTTCAAACTTGCCATACTTTTTCCTCTTTAGCATCTCCTGGTGAAAAATACCACAGC
TAGCATCTCCTCCTTGTTTTTTAGACCTAGGCCTAAACAAATAAGGTTAGGGAATGTTAGGTTTCAAGACCTCATCTTTC
AGAAGGTGCTCACCCCTGC
Sequence Type genomic DNA
Unitrap ID UNI684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4556110..4556289 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005718 (Tcfap4) NM_031182 transcription factor AP4 Gene [Source:MGI Symbol;Acc:MGI:103239]

 
Come back to gene ENSMUSG00000005718


For any suggestions or comments, please send an email to unitrap@crg.es