Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D063F08
Clone ID D063F08
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D063F08
Sequence
TCTTGAANNNNTTTCATTTCAGAGAGCGCGCCGTGTGTTTTNNTGCCTCAGGGGGAATCAGGGGCCAGGGGAGTAACCCA
AANNTGGGNNAAGCAAAGGCATTTATTCCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD063F08
Sequence
ATGGCGTCCGTGTCTTCAAGGACAGAGAGTTTCAGTGATGTCTGGATCACACGGCAGCCAACACGGAAGTGGTTTTTGTT
TATGGGAGTTTTCTTCTAGGAAGGAAATGGGAACTCTTTGCCTTAGAACCACAAGCAGAAGCTGTTGGGGGGAATAAA
Sequence Type genomic DNA
Unitrap ID UNI10439

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141791452..141791609 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]


SPLK-Sequence tag 3SD063F08
Sequence
CTGATTGTACCAAACTGGACACAATGCTCAGTTTAAAGATC
Sequence Type genomic DNA
Unitrap ID UNI10439

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141791365..141791405 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]

 
Come back to gene ENSMUSG00000040606


For any suggestions or comments, please send an email to unitrap@crg.es