Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D063F05
Clone ID D063F05
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D063F05
Sequence
GGTGCACCTCCAGGTCTGGAGAACTTCCNNNACGCTCGGAGGGNNNCCACAGAAGAATTTTCAGCTGTTTGCCGTCAATA
GTNNAACTAAACAAGAAGTTCTTCCCGTCCGAGAGGAAAACCAGGATGTGCATGAGGAAGAAGTTACTGTTGAAGATG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD063F05
Sequence
GATCTCTTTCTGAAGGCATAGATGATGCTATCAGGGCACCCTTGCATCACGGTGGCCAAAGAGCCGCATAGTAATGGTGT
CACCTGGCTGGTCCTTTTACATTTCGGTGTTAAGCCCCGCT
Sequence Type genomic DNA
Unitrap ID UNI486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6007334..6007454 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


SPLK-Sequence tag 3SD063F05
Sequence
TCATGGCTGATGAGCGCCAGGACGAGCAGAGTTGAGCTGGGCGTGTTTTGATATAAGGGGTGGGTTCAGAATGCAGAGAA
TTCTGGAAAGACTCCAGGAGCTCGTGGGGGGAAAGTTAAACAGTTCCAGATGTCCCACACAGTAAGCTGTGCCTGGGGAC
AGAGAGCACTGGCTATTCTAAACCTGGATAGTGAATAGTATA
Sequence Type genomic DNA
Unitrap ID UNI486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6007108..6007309 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es