Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D063C11
Clone ID D063C11
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D063C11
Sequence
AAAGCAGGAAATGGAGAGAAATGAGATCCCATTCTTGTGCCATAGCAGTCCTNNNTATGCTAAGATTCTGTGGAAGAAAG
GAGAGGCCGTTGGGTTTTATTCAGTTAAGCCTACAG
Sequence Type mRNA
Unitrap ID UNI9104

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97867551..97867666 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


SPLK-Sequence tag 5SD063C11
Sequence
GATCCCATTCTTGTGCCATAGCAGTACTGACTATGCTAAGATTCTGTGGAAGAAAGGAGAGGCCGTTGGGTTTTATTCAG
TTAAGCCTACAGGTGAGTTTTATAAGTTACTTAAACTGTGTTACAGAATCTCCATTTTGACTCTCAGCTGTATTAGTATC
TGTTAAATCAAGCCCTAGAGAGCAAATTGAGATGCTCGCACTTCAGACTCCTTGGGAGTGTCACAGCCTACTGTCCTGTG
AGAGAGGACAGCTAGAAAAGCCTACTGAAGCGTGAAAAACAAAAGATGGTCTTTCTTTATTTCTGTACGGAGAGGAGACG
ACTGTCATTTCACCTTGGTCTTAGCCTTGCATCTGCTCTTTTATTAAAGGTTGACATTTTGATTTCTGCTACTGTTACTG
TTTCTT
Sequence Type genomic DNA
Unitrap ID UNI9104

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97867575..97867980 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es