Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D063A10
Clone ID D063A10
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D063A10
Sequence
GGCAGCTTTCGGACGCTTTAAATTCCTACGGGGTGGAGGGCTTAGCTTGGGTGCCCGGGTCTGGTTTCTCACTCGCATGG
CTGTGGACGTGAAGTCTCGAGCGAAGCGCTATGAGANNNTGGTCTTCCTCGGAGAGGGACATTTTGCGACGGTCTATAAG
GCCAGGGACAAGAACACCAACCAAATCGTCGCCATTAAGAAA
Sequence Type mRNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101500413..101500870 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]


SPLK-Sequence tag 5SD063A10
Sequence
GTATACAGTTAGAGAATTTTCCAGCCCTCGTATAAAGTATAAGGAACAAAATGTCTTTGGGATGCCCATTGCTT
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101494004..101494077 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]


SPLK-Sequence tag 3SD063A10
Sequence
CTCAGTTGAGCCAGCTTTCAGGTCCAAGATATTTATTGTTGGTAAATTTAGTTGTTTGCACATTTAGTGCAGAAACTTAG
AGTAGAAACTTGATTCTTGTTTGGCTTTATGTGTTAGAGCTCACACTCTGCTAACCATGCTATGACTCTTTTGGATTTCT
GGCTGTCCTCCTGAGTTACATACTGCTACATGTTTTTACTGTAGCTAATTTGGGTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101493375..101493594 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]

 
Come back to gene ENSMUSG00000069089


For any suggestions or comments, please send an email to unitrap@crg.es