Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D062G04
Clone ID D062G04
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D062G04
Sequence
AAGGAAGAAACANNTACCTTTNNNTTCCTGNCCAAATTTTATCCTGAAAATGCTGAGGAGGAGGTAGTTCAAGAGATCAC
GCAACCCTTATTTTTCTTTCAGGTGAAGAAGCAGATTTTGGATGAAAAGGTTNNNTGCCCTCCCGAGGCGTCCGTGCTCT
TGGCGTCATATGCTGTCCAGGCCAAGTATGGCGACTATGACCCCTCTGTGCACAAGCGGGGATTTTTAGCCCAAGAGGAA
TTGCTCCCGAAAAGGGTGATAAATCTCTATCAGATGACTCCGGAAATGTGGGAGGAGAGAATTACGGCTTGGTATGCGGA
GCACCGGGGCAGACCCAG
Sequence Type mRNA
Unitrap ID UNI10441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4706257..4718609 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]


SPLK-Sequence tag 5SD062G04
Sequence
TTCACCTACTGGCCTGGGTTTCATGGCTCAGATAGCTCTTGCCTTAATCTTCAGCAGTAACCCAAGAGATA
Sequence Type genomic DNA
Unitrap ID UNI10441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4704261..4704331 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]


SPLK-Sequence tag 3SD062G04
Sequence
AAATCACTTGAGACAGATGTCACTATTTACCAAGGCCAGAGTGTGAAATTGAAGCCAAGAGTCAGTGTAATGAATCTGTT
TTCTTATTTTCACGGGGATGGGAATCTCTGGGTTGAGAAAAGTGTTGCTGTGTCTGGTCTGTCTCATCTTCTGCAGGTCC
CTTCTATCTCACCAGAGGCATGCTCAGAATATTTGACTTGGCAAGAGTCTGTCCTTCATCCTTGTCACTTAGCCCTAATA
ATGGTGTCTTCTATTCTCCTCACAGGGATGAAGCTGAAATGGAGTATTTGAAGATAGCTCAGGACCTGGA
Sequence Type genomic DNA
Unitrap ID UNI10441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4703712..4704021 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es