Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D062E09
Clone ID D062E09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD062E09
Sequence
CCCTTGACATCTACCCGGCGAGGGTTCTCATTGTACTTTTCAAGTGGCATTGATTTGTTAAAGCGCTGAATTAGCATCTC
CGGCCAGCTGCCCGTTCATTCTACAGGAGTGTCCAGGGGCCTCAGTCCCTCCTGTCTCCCCCAGATGCCCCGTTTGTATT
TCAGCCCCCTCCTTTCCCACCTGATTCTTCCACTCCTCCCCTCATCCTTTCCTGCTCTCAACTTTACTGTCCTTTCCTGC
TTGCCTTTCTTTCTGACTGGTCCTGTCCAGCACCACCGTCTTAGGTTTTCTTCCTCTCTCTTTGTCCATACCTCTTTCCT
CCTCCTTCCTCGAAGGCTTTCCTACATTCCTTC
Sequence Type genomic DNA
Unitrap ID UNI30250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84172897..84173249 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]

 
Come back to gene ENSMUSG00000028487


For any suggestions or comments, please send an email to unitrap@crg.es