Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D062B07
Clone ID D062B07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD062B07
Sequence
GATCCTCGAGGACTTGCTATTGCTAACAACCCCCTCTCTGCTTTGGTGTTGTTTGTAATGCAAACTTCCTTAGTGAATAT
GCAAATGTCAGTCCTGTGTACTCTTGAAATTTACTTACTACACAAGGTCAACACTGCAGTTATGCCCCTGTAGCCTGTGG
TCTTCTTTGGGAGCTGTGTGTATTCTAACTTCATGTAATAGTCTGGTAGGACCCAAAGTTGTGGTGCTTGTTATCTACTA
CCTAGAGAGCTATAGACACTTTTAGTTCATTTTGATAAACAGAAGAATTTAGTTTGTCCCCTAGTCTTTGTCTTATAAAT
CTTGGCCACACCCAGTCATGGCTTCTAGGAACTTGTAGCAGGTGTGGGAAGGCTTGCAGATAACATGNNNACGCTGGCAC
TGACTCCAGCTCTATTTGTAATGTCAGTTCCCATCTGAGCCCAGACCTCTTTGGCTCTAAAT
Sequence Type genomic DNA
Unitrap ID UNI12212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44724733..44725194 456
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]


SPLK-Sequence tag 3SD062B07
Sequence
CCCATCCCAAAGCTGGGGCTGGGAGGCNNTTTTATGGCTTGCTTTTCTCACTCCTGCTTGCACAGTCTATGGGATGGTAA
TGGGGTCACACACCAG
Sequence Type genomic DNA
Unitrap ID UNI12212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44724615..44724710 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es