Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D060F04
Clone ID D060F04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD060F04
Sequence
CAGCTTGTAAAAATAATGACAGATGAGTTAGTATATGCAACACTTTAAGACTTCTACATAGTCTACTTAAAATAGGATGA
AAGAATACAGCCCAAATGATCAAAAAGATAGAAGAAAAATGAACTGAGATAGAGCAACAACAGGTATGTGAAAAGGACAG
GGGAAGGAAACTTACTGGGTACCATAATTCGTAGACAGGCATTAGTGAGCCTTAACCACCCTGCTGATAGGTGGTATCCC
TCATTTTGTGTATGATGAAAAAGATACAGAGGTGTATGATCTGCCCAATCTTCATAGCATTTATTATTGGCACCACAAGG
GCTAAAAGTTAAATTGTGCTGCTAAAGCTTGTCTATTTTCACAATCACATTATTTTCTTATTTTAAAAACAAAACAAACA
AACAAAATGCTTGGAGACATTTTGAATGGCACGTGCAGAGGGGGACTGGCAAGCCCAGACCTAAGCCTGTGAGTCTGAAG
ACTCTTACTCATTCAGATGTGTTTTGAGCACTTTGAATGTTGTTACTGGGTTACTTGTCGGATAAGTAGAATCTCTCTGC
AATCTGGGCCTACAGAGAAACTATCTGCATTTTAATGAGACTCATATGCATAAAAAGTTTGAGAGTCTGATCTAGATCCC
Sequence Type genomic DNA
Unitrap ID UNI29773

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100116217..100116856 626
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041632 (Mrps27) NM_173757 mitochondrial ribosomal protein S27 Gene [Source:MGI Symbol;Acc:MGI:1919064]

 
Come back to gene ENSMUSG00000041632


For any suggestions or comments, please send an email to unitrap@crg.es