Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D060A05
Clone ID D060A05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD060A05
Sequence
TATTTCACACAGAGACTCTCAGAGAGAATATAACTAAGCGTGCGCGCACCCCACCCTATAANAAGGTCTCTGTGATATAA
AACACACTCAGATAGTCTCAAGGACTGGAACCTCTCATAAATGAAAAAAATGTTTTATATTTGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD060A05
Sequence
TTTTCAAACCCTTTTTTTAAAAAAGGGCCCCTCTTTTCTTTTTTTTTTTTGGTTTTTCGAGACAGAGTTTCTCTGTATAG
TCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCCGCCTGCCTCTGCCTCCGGAGTGC
TGGGATTAAAGGCGTGTGCCACCACACCCGGCCTTAATAATGTTTCTTAAACACTATAACCTCCCTTGCAACCCACCACC
CACCAGAGGTAGTAGAAAAGAAAGAATAGGGGGAAAAGAGGACCTGTTTACAAAGGGTATTGCAACAACTTCCATCTGTT
GTCTGGAAATCCAAAATTCAGTTCACAGGTTAGCAGCTGCAGCTCCATCCACTCACAGATACTTCATGGATATACCAGTG
GTCCAGTTCCGTAGAGTTGAGCTAGCAGACACGATTCAGCAGAGGTAGCACTACCTAGCAGAGACAGTCAGGCCTCAGAC
TAGGCTCGGGTCAGCAGGACAGACCAAGGAAGAATGCTGGGAAGCAAAGAT
Sequence Type genomic DNA
Unitrap ID UNI14584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115714081..115714579 491
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041740 (Rnf10) NM_016698 ring finger protein 10 Gene [Source:MGI (curated);Acc:Rnf10-002]

 
Come back to gene ENSMUSG00000041740


For any suggestions or comments, please send an email to unitrap@crg.es