Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D059H02
Clone ID D059H02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD059H02
Sequence
TCAAATTGTATTTTATAATCATAAACGAGAGAAAGGAGAACGCTGGCAGTATTTAGATGCTTAAACCCTAAACTTGCCGA
GTGGCATTTCAAATTAGAGTTAGAGCAGTTTTTGTCAGAAAAAAAAATGTCACCGTCACCGACGTTTGGAATATTGGAAG
CCAGAACTAGATAGTGGGCAGGAGAGATTCCCAGCTGCAGGAAGTGATGCGTGTTTGGGAGCTGGGGTCTTCTGCTTCTT
TCTAGCAGCTGGGAANNNGCAAGGCTGTGATGTATCTTCCTGACACGTGTCCTCAAGAGGTGTACAGATGAAACTGCAGT
AACT
Sequence Type genomic DNA
Unitrap ID UNI22626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57287091..57287414 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]


SPLK-Sequence tag 3SD059H02
Sequence
TACTTCCGGTTTGAGAATCCATTGGAAAGCCAAACATTTTGGCTGCAACCAGCATTCCTTAGGTGCAGTGTGGTCACACT
TTCTTGGCTACAGTCTTGCCCGTATCCTGTGGTCACATTTTCTTGGCTACATTCTTGCCCATTCTATTACTGGTAGGTAT
ACATGGAAATTTTATACTTTGTCCTTGATTAAACTGAGAGAATTATAGTCTCACACAGAGGCCTCTTTCTCTGCTGTGTA
TGTGTTCTCTCTGTGTCTCTCTTAAATT
Sequence Type genomic DNA
Unitrap ID UNI22626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57286805..57287073 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es