Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D058D11
Clone ID D058D11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD058D11
Sequence
AAACTCCCAAATTTATTTTTATACTCTGTATTCTCAACTTAGAATTTAAATAATCTTATCATACTTGCATATACTGCTTT
AAACATTGATATTTAACATATTCAGAGCTCC
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30905749..30905859 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]


SPLK-Sequence tag 3SD058D11
Sequence
AGTCCGTTTTCTCCTAAAGCCTTTTGGTGGTTTCTGTTCATGGAACTCTGTCATGCTTGCATGTTAAATGTTTTTATATG
CTGAGCTATTTCTGTCCTTACTTGCTTTTTTATGTGAAGAATTCATGAAGTGTTTTTCTGAACTTGCTTTTATGTTGGCC
TAATTGACTCCATAATTATTAACGGTTTTCTGTCAAGAAGAGCAATGAGTGANNAAG
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30904968..30905184 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es