Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D057H12
Clone ID D057H12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD057H12
Sequence
CTTAACATACAATCCTAAAATGCAAGTGAATTGCACACGTGGAATGGCAGAGCAGACTGACTGAGAGAAATGGATATAAA
GCTATTCTTAGATGGGTCTTTACTTTTTTAAGTGTGTTAATAAAATAAATAAGCTTGCCATCAAGTCTAATAACCTGGAT
TTGATC
Sequence Type genomic DNA
Unitrap ID UNI30256

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 115488975..115489140 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040282 (BC052040) NP_997147 Uncharacterized protein C15orf41 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3U4G0]

 
Come back to gene ENSMUSG00000040282


For any suggestions or comments, please send an email to unitrap@crg.es