Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D057F02
Clone ID D057F02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD057F02
Sequence
AGATCTGGGTGTTTCCGGTACAGTTTGAGATGGGACCCTTCTGCCTTGTTCTGAACCCCATAAAGTCTAAGACAACCCGT
TCTTCTCTTG
Sequence Type genomic DNA
Unitrap ID UNI29628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97662171..97662261 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]


SPLK-Sequence tag 3SD057F02
Sequence
AANCCTTTTGGTCCTCATAGATACGTTGTACCTGGCTCTCCAAGCTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es