Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D057E05
Clone ID D057E05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD057E05
Sequence
GTGGGATCCCAGGAATGCGTGTCAGCCGCTTAACTTAAATGTGCAGTATCCCACTCCGCATCCCCAGACAGTGCGTGCGT
GCGTGCGTAGTATGAGGAGCGCTGAGCCCACCAAGCCTGCCCGGTGTTGAAGCTCCCTTTGGAGGTTGTGTGCAGCTGTT
TAGGGGAGACCAGCTGTGGGCCCCCCAGGAGAAGGGGTTCTTAGTATGGACTTAAGAGAGCCCTGTTCTAAAACCTCAAG
ACTCCATCACTTTACCTGAGGCTTGGCTTTGTTTTGTTTTTATTTTTCATTGTGAGACAAGGAAATACATCTCGACATGT
TGCAAAAACAGAAAGGGAGGTGAAGGTGGCCTCGAGGTTATTTCCTACCCAGTCAGACAGGCACACACTGTCTGACGGCA
CGAAGCCTTCATGCTTTTCAGGGAGCCCTGACAACCAGGAATGTGTACAGAGGAATTGTGAGGGTGTCGGGGTGTGGGAC
GGTGGAGGAGTGTGGGAAGAGGCAGATGCTGGAGAGCCCCAGGCAGATGGCTGGGAGTTATCAGAGCTGCGTTCCTGTGT
TGAAGGATGCTCTATGGGAGTAGTCCTCCCTG
Sequence Type genomic DNA
Unitrap ID UNI27555

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12356467..12357058 574
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023827 (Agpat4) NM_026644 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene [Source:MGI Symbol;Acc:MGI:1915512]


SPLK-Sequence tag 3SD057E05
Sequence
AGTAGGTACCTGAAGAGGGCTCCCCAAAAGATGAATTCAGAGGTCTCATGATAGGCTCTACCCTAGATGAAGCAAGGCCT
CTGTTCAGTTCCATGAAGCTGGGCATGAACGTGACGGGTTTCTTCAACATGGTCGCCTTGTTCCTACGCTCACAAGCCAT
AGAAATCAGCCTAGGTCGGCATGCTTACGGGGTAGAAGGTTGTACCTGCTGTTGTTCTGTTGAAAGGATCCC
Sequence Type genomic DNA
Unitrap ID UNI27555

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12357078..12357309 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023827 (Agpat4) NM_026644 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene [Source:MGI Symbol;Acc:MGI:1915512]

 
Come back to gene ENSMUSG00000023827


For any suggestions or comments, please send an email to unitrap@crg.es