Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D057D03
Clone ID D057D03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD057D03
Sequence
ANCCCTGTTCCAGGGCAGACAGCGTGTCACANNNATGAAGGGCTGGCTTGAGAGAGTGCAAAGGCTGCAGTAAGCNNNGA
GAAGCGGGGACATGCTGAACATTCAGCAGGGCCCAGGCAGGTAGACGGGAACCCAACTTAAAAGAGGCAGAGCCCACCGG
GGGAGGTGGGGAGGAGTCACACGTTTGACTGGAAGAGAAGCAAGTGGTAGATGTGTGAGGGGGTCAGTGTGGCAGGGGCT
TCTTAGACGCGGGCATGTAGACAAATGTGAGTTGGAGGGAAGAGATGGCATTGTGACATTGTAGTGTCTGTCCCCAGTGA
GTACTGTGAGGTGGGAGGGCAGTGAGAGATGGAATAGACAGCTGAGGTGGACCTTCACACGCTGGTCACTTGGTGGGAGC
CACAGAAGGTTCTAGAACAGATGTCATTCTGAGGAAGGTAGGAGCAGCTGTGTGGAGAAACACGTAGGTGCAGAAGAAAG
TAGCTGAAGGCCTGGTGACATGGGTAGGCCTAGTTTCAAAGATGGCAGAGGGTGTGCTCTCCCTTCTAGGCTGACTGTCC
GTCACCTTGCCTCATTCATGGAGGCGGGGCAGAGAACTAAGACTGAGTTCTAGCTTGCCTCCTTGGCCTCACTCCACTAC
CTNNNCTTACCAACGGAAGCAGCGGAAGCAGCGTTCTGCCTCCCTCAGGGGTGTGGCAAGAGTGAATGAACCACNNNNCA
TAGTGTTAGGAGAGTACTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD057D03
Sequence
GCTCTAGGTGAGTGTCCCAAGGGCCAGAGAGCCTACATGGGGACCCCCCAGCTGGGGAACTTAAAAGTATTGGAGTCTCC
CGTGGGCCAGTAGACTTTAGGGCCATGTTGACATATGTCCATGTCCATTCACACTCTCTGTGTTGACTCTTGCACTGGTG
AGCAAGGGAGCCTGTGGGGCTTCAGTTTGCTCATTGTGAAAGGGGATGGAGGCCAGTGCCTGGTTCACGGCACTGTTGCA
GAGATGAAGTGGCCTGCTTGATGCTGGAGAAGGACTTGGCGATGGGCATGGCTGGGGTCAGTCCTCATTCACATCCAGGT
TGTTGCCACTTCCATAGTAGAAGCATCATTTCCTGTCCAGTGCTTTCAGGAAGGTGCCTCTCCTCTCTTCCTGTCACTTC
CCTGTAGAGAGTCTGGACCGGAGACTCCTCTCCTCCCCCAGCCCCAATGAGTCTTGAAGTCTTGGCCAGACTTGTGTGTA
GTAGGGAATGGTCCCAGCCTGGGCTCCACCCCTTGCTGGCCGTGGGAAGTTGTGTCGGTCTGTCATCACTGTGGCACTGC
CTTCTCATCTGTAACAATGGGCTGATAATCCACACATTGTGTGAGGGCAAAGCTGTGTGGCACACATGAACTACTGCGTG
TGCCATCTCCGGGGCCAGAAGCCTCTTGTAGCATCCTNNNNAGCAGAAGAGA
Sequence Type genomic DNA
Unitrap ID UNI1463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26720293..26720984 660
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001576 (Ergic1) NM_026170 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene [Source:MGI Symbol;Acc:MGI:1914708]

 
Come back to gene ENSMUSG00000001576


For any suggestions or comments, please send an email to unitrap@crg.es