Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D056H06
Clone ID D056H06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD056H06
Sequence
GTAAGATTATTTCAATATTATTATGTGAAATGAAATATGGATGATGGAGCCAACCACCCAAGTGTCATGCCAAGGAAAAC
ATCAAATAAACCTAGAACAATGGAAAAAAAAGAGAATTCCCCAT
Sequence Type genomic DNA
Unitrap ID UNI3595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31863654..31863777 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es