Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D056D12
Clone ID D056D12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD056D12
Sequence
TAGTGGGATCCATGTGTCTAGAAAAACCAGGTGGCCTTTGTAATATGAGGTGACTGGGTATGGTAGCATGTTTACCACTC
TAGAGTCAGTGGGACCTGATAAATGAGAGAGACAAAAGTTTCATTAAATAACCAACTTTATTCAGAGCATTTATACTCTG
AATAATTTATACTCTGAGGGTTAAGAGAAACCATATGAGTAAGATCACAAGGACCAGCCAAATGTGGATAGTTTACACAT
TTAATTGAGTAACAACAAACAGTATGAGGAAACTGTTAAGCTACA
Sequence Type genomic DNA
Unitrap ID UNI12755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108548833..108549117 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]


SPLK-Sequence tag 3SD056D12
Sequence
TATAAACCTAGGCACTGAAGTGTGTACTTCCAGTTTTCCTATGCAACTGTGGGAGGTGGAGACAGGAGACTCTGGCAGGT
CTTTGGGCCAACTAGCCTGGTTTATACATTGGTAATACAAACCCTACCTCAAATAA
Sequence Type genomic DNA
Unitrap ID UNI12755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108548264..108548399 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]

 
Come back to gene ENSMUSG00000064145


For any suggestions or comments, please send an email to unitrap@crg.es