Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D056D07
Clone ID D056D07
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D056D07
Sequence
TNNNCTCNNNGACACCCCTGCAGCCGCCATGGAGGAGCTGCGGCCAGCACCGCCGCCACAGCCCGAGCCGGATCCGGAGT
GCTGCCCAGCGGCGAG
Sequence Type mRNA
Unitrap ID UNI10455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12511364..12511449 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014426 (Map3k4) NM_011948 mitogen-activated protein kinase kinase kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1346875]


SPLK-Sequence tag 5SD056D07
Sequence
GATCCTTTTACTGTCTTCTAGCAACAGCCTGATGCAGTGTTGCGCACGAAAATAGCTAAGGGTTTATGTGTGAAACTTTG
CTACCGCAGGAAGCTCCAAGATGGAACTTTGGTACCCAGAGTATCTGTTGCATTCTGCTCCGTAGAAGCTCTTTTAACTG
CTACGAAGAGTCTCAAGTTTTAATTGGGAGGGTAAACTCACGGTGTCCTGATTTTGTGTTTAAATGCCAGTCCTTTGCAT
CTCAGGATAAACTTTGACTGCTTCCTGTCCCCTATAGTGAAAACACTCCCACAACTCCTCCTGGCTTAAGGTCTCGCTCT
ATAACCTCAGGAAGAAGGCAGTTAAATAGCTTTGCTTTTTCCTGCTTGAAGAAATAGCAAATTTATAGTTGTAGCGAGAC
CCGAACACGGGAGCCATTCACATCCTTGCTTGTCACCACTGGGTTGCCTGAGAGGAATTTTACTTTTTCAAAGCCGTGAG
AGCTACTGCATTGTGTTTCTTAATTTCAAGATAGTTCTGTGACATCTTTTGGGGCATTTTCTTTAAGGAATAGTACAGG
Sequence Type genomic DNA
Unitrap ID UNI10455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12510359..12510917 559
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014426 (Map3k4) NM_011948 mitogen-activated protein kinase kinase kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1346875]


SPLK-Sequence tag 3SD056D07
Sequence
TGAACAAAAGTCTGGCTGCCTAGTTTGTGCCTTAATTATCACGAGGAAGAGGGATGATTTCATACCCACAGACCCGACAT
TATAATTCTATGTAACTGTTCTCGGGGGAGAAAATGGACTTGAGCGGTGTTAGGCAGAGGGATAAAAATCTGCTATCAAA
ACGCTGCTTTCCTATTGATAAACAGCCTTGCCTTCCAGCCAGGAGCCTGTCTCTTTGTTATAATAAAAATAGGTCAGGAT
AATGGGCCTCATCCAACTTTACGTGAACAGCAGTGTACAGAACAAGGAG
Sequence Type genomic DNA
Unitrap ID UNI10455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12509799..12510087 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014426 (Map3k4) NM_011948 mitogen-activated protein kinase kinase kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1346875]

 
Come back to gene ENSMUSG00000014426


For any suggestions or comments, please send an email to unitrap@crg.es