Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D056B07
Clone ID D056B07
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D056B07
Sequence
CTAGCNNCNCCGGTGTAGTGNNCTCCCGGAGCCGTGTGCCTGCGTGGCGTCTTCAGAATGTCCGCCCCTTTTGAGGAGCG
CAGCGGGGTGGTTCCTTGCGGGACTCCGTGGGGACAGTGGTCCCAGACCCTGGAGGAGGTGTTCATTAAAGTCCAGGGGC
CCCCCGGCACTCGCGTGCAGGACATCCAGTGCGGCCTGCAGAGTCGGCACGTGGCTCTCACCGTGGGTGTCCGCGAGATC
CTCAAGGGGAAACTGTTTGATTCTACAATTGCTGATGAAGGAACATGGACTTTGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD056B07
Sequence
AAAACCAAAAAAAAAAATAGTACCTAATAGCCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD056B07
Sequence
CAGATACTCCATTCAAACGCACAGGGGGTCATAAGCTATACAAAGGTGTAAAAAGCCTTTTAGGTGAATTTTAAAGTGAA
TGGTTAGAAAATTGCTTATTATGTAGGTTTCAAATTTCACAAATGTATGCATTTCTGTAAGACCGATGCTGAATGCACAC
CAGTAATTCATGAATAATTAACCTAAAGAACTGGACCGCTGTAGGTACATAGTATGAAAGGGAGCTGTCCCTTCATTGGA
TTCTCCACCTCTTGCTTCTGCCTCTTGATCGGCCTTTTTTAGTGGTAGTTTCCACCGGCATCATGCTGACTTCCAGGTAT
ATGTCTGACCTAGACTTCTCGGTTCCTTGTTGCGTATACTCATTTTTCTGTCTGCCAGACGTTTTGTGTCCAAGGTGAGC
AATCTAAGCAATCTAATTTCGCTCCCACATTTATTCTACTTTTTATTGTAGTTAGTGGAGACTGGTTGTTCATGATTTAG
GGTTGGGAGGA
Sequence Type genomic DNA
Unitrap ID UNI9838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40550175..40550665 489
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020328 (Nudcd2) NM_026023 NudC domain containing 2 Gene [Source:MGI (curated);Acc:Nudcd2-001]

 
Come back to gene ENSMUSG00000020328


For any suggestions or comments, please send an email to unitrap@crg.es