Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D054H12
Clone ID D054H12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD054H12
Sequence
GATCCTCCCATGTCCCTAGTACTTAGGGGNNTGGCTCCAGAAGGCCAACAGCGAGAGCCAGGCCACTCCTGGAAATCCCA
TGATTTGTTTGACTAGTGTTAGACTTCAGAATTACTAGNNNCTTTAAATCTTAAAGTAGCCATTGCCTAGGTAGTTTGTA
ATTATTTTCTGTACTAGGAACGTGAGGATGAAGTTCGGACTGTCTTTCGGTCAAACAGAAAGGAGAGGGCACACTCCTCA
CCACCAGCATCGAGTAATGTTGGAGTTTGTGTTTGTGTGTAGCTGTGTACCACTGCTGTTGCAGANNNNNTATCTCATGC
AGTCATTAGTTGCTTTATATTTCCACAGTCGTTGCTGCTCCTAGCTTACCTCATAAGAAATGGATCGGAGCGAGTTGTTA
CAAGTGCCAGAGAACACATTTATGATTTGCGATCCCTGGAAAATTACCACTTTGTAGGTGAGCAATAGAAAACCCTCATA
AGCAAATTAAAACAGTAGTTGGAGTTGTCAGTCACCTGAACCAGCTTGGAAGCTTCTCTGCTCTAATTAGCATGTGACTC
TTGCTGGTTGTGTGACGAGTGCAGAATCCAAGGCGTGGGGCCCTAGAGTATTAATTAGTGAAGACAGGAGCTTGCAGAAA
GGACTGGCTAATAACAACAGAACCTACACAACATGAGT
Sequence Type genomic DNA
Unitrap ID UNI30260

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45699587..45700262 636
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006169 (Clint1) NM_001045520 clathrin interactor 1 Gene [Source:MGI (curated);Acc:Clint1-002]


SPLK-Sequence tag 3SD054H12
Sequence
CCCCTNTNGTGTCCATAAAGGAATAGCTTTAATCATGTGGGAAGAGAAGGTTAGAGCTCCAAAACACACACATCTGTTTG
AAGCCAGGCCCCCTCACAGCCGATAGCCGGCTCAGTGAGGCCCACAGGCTCATTCTGCACATGAAGGCAGCACAGGGCAG
GGAGCGTTTCCTTTGGAGCCTGTCTTCCTTGTGACTACTATAAAATAGCAGGCTTTAGTTGCACTAAGTCCTAGTGATTA
GTGTTCCCAGTCTTGGGGAAACAAGATATTTGGGGTGCTTTTGGGCCATCAGAGTGTTAAAAGTGAGTGGTCATTCTTTA
TTTGTTAAAATATGATAGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000006169


For any suggestions or comments, please send an email to unitrap@crg.es