Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D054G04
Clone ID D054G04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD054G04
Sequence
AGCTGTGCTTGTCTCTTCACATCTATCCTTCATAGATGGTCTGGGAGGGTCACAAGACCCACACCTGAGCAAGTATTCTC
TCTTTAACACCTGCTGTATGCAAGACTGCTGCTTACAGCACATGGCCCTAGAGCAGGGGTAAGGTATATAGGCTGGCGAA
GACTGCAGAGAGGGGGCTTTGGGGACATCATTTTCCCTGCTTCTGGTGTGTCCTTCTTGTGGGGAGCACATATGCTGACC
CATCCTCTGTGCTCTGTCAGGAAGCCACTCATGTAATTCATGAGTACATGAGTAAAATCATGTACTCATCCAGAGTAAGG
CTTGGTGTGTTGTTGCCTACCCTGGGAAGGAGTTTTAGTCCTACTGTCTCCCGAGGGTGGTGGCAGCACTGGGACTGTGG
CTTCAGAGGTGAATTGCAGACAACACTGTGCTTCTGGGGTTGTCTCTCCGCTAAGAATAGGGGAGCTAGGCTGGGTCTCA
CCATGGCTCACCCATAGGCAAGGCAAGCCAGTTCTTTCCACAGGTACTTG
Sequence Type genomic DNA
Unitrap ID UNI23167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117853766..117854296 517
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017715 (Pgs1) NM_133757 phosphatidylglycerophosphate synthase 1 Gene [Source:MGI (curated);Acc:Pgs1-001]


SPLK-Sequence tag 3SD054G04
Sequence
CCTGCTGCGCACCCAAGGTGCTTTCTGTGGGGTGGCAGTTTGGCTATTCTGACNCCAGCNNGANTTCATTCAGAGGCATG
TTGAGGGGGAAACTGTTTTACCTGGGACTCATGTACACCAGGCTGACTTCGCCATCCATTCAGGGGCCCAGAGAAGCATG
TACATGCTGTGTGCTGGGGTGAATCAGTCTCTAGGACGNNCTGATGATGNNAACAAGCCTATTTCTCAGCCTGATCCACT
TCAACCTTTCACAGTCGTACTCCCTCCATAGGACCCTGCCTATTGGCTTTCCAGCCATTCCTGAGATCAGGAAATTTGTC
TGCAACATCTCCAGGAAGCCTTAATTCTGTTGGCTGAACCTTGACCCAGAGTCAGGTATCCTGTGGGTGTGGCCTGCGCA
CTTGTGAGAGGATGCTGTCCTGGTCCGCAGGCTGCAGGCTGAGGATGCCTTTGTGCTGATGAGCCCACATACTACTAGNN
NTCGGAATGAGTGCTTCCAGGCCTTGGGTGTCGGGTGCCACTACCGCTGACCTGCAGCTCTGTCACTCTCAACTCTCTGG
ACATT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017715


For any suggestions or comments, please send an email to unitrap@crg.es