Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D054F10
Clone ID D054F10
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D054F10
Sequence
TCAGCCCCATCCCTTCCCCAACCGGCACCATCAG
Sequence Type mRNA
Unitrap ID UNI10463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142911247..142911280 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]


SPLK-Sequence tag 5SD054F10
Sequence
GATCTCACTTTGTAACTCTGGAATTCACTACATAGGCTGGCCTCAATTATCCTGTGTGCGTCTGCCTCCCCAGAGCTGGG
GCTAAAGGCACAAGCATGCCTGGCTT
Sequence Type genomic DNA
Unitrap ID UNI10463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142915736..142915841 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]


SPLK-Sequence tag 3SD054F10
Sequence
AAAAGTGGTGCGTGCTGGGAGTGGGGCTGGTTGGTGGAGCGCTGCTTGCCAAGAAAGCCTGCAAG
Sequence Type genomic DNA
Unitrap ID UNI10463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142915869..142915933 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]

 
Come back to gene ENSMUSG00000056493


For any suggestions or comments, please send an email to unitrap@crg.es