Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D054E06
Clone ID D054E06
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D054E06
Sequence
TNNNNNNNCTTTTTTTAACTCTTTAAAAAAAAGGGGACCNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTTCCCCCCATCG
GCGCTTTGGATTCCNNNNNNNNNNCATCCGCACTAGCCTCCCTCAGGGCAGGCGNNNGGTTTTTTGAAACCCCTCCCGAT
CCATGGTATCTNNNNNNNNNNNNNNNNNNNNNNGCCAGCATGCCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD054E06
Sequence
AAGAGAGACAGAAACAGAGAGGCAAAAAAAACAAAGAATATCTGTCTGTCTGTCTGTGTACATAGTTGT
Sequence Type genomic DNA
Unitrap ID UNI30261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108272232..108272300 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]


SPLK-Sequence tag 3SD054E06
Sequence
GCATCCTCCCATCTCTCTGAAGGATTCATTTCAGCATTTCAGACTAAGGACCAGTTGTCTGTCGGGGACTTGGGACCACA
CTATAGTCAGTTCCTTGGCTTGTGTTTTTCCCTGGCCCAAGCACTGATAATGAGGTGTGGTTGTCTTTGTTTTGGGGGTT
CAGCCCTACAGTTTAAGTCTCTTGGCTTGTCTGTCATACTGGCTCAATTCTGGACATCAAATGGGTTATAAGAAAGACTG
GGCTTAAAGGCGTGCGCCACAAT
Sequence Type genomic DNA
Unitrap ID UNI30261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108271573..108271836 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]

 
Come back to gene ENSMUSG00000013150


For any suggestions or comments, please send an email to unitrap@crg.es