Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D054C03
Clone ID D054C03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD054C03
Sequence
AGGTGTTTTCTTCTATCACTACCTATTCCTTTGAGGCAGGCTTTCTCCCTGAGCTTAGAGCTCTTGTGTCTTTCAGACAG
TATGCCCCATCAGTCCTCGGCATCTGCCGTAGCATTGTAGAACAGGCACATTCGAGCCCATGCTCGCCTTGTTCTGACGG
GTTGCTGAGCTCAGGTCCCTGTGATACTGTGATACTGTATCAAA
Sequence Type genomic DNA
Unitrap ID UNI28206

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20308952..20309154 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060510 (5730601F06Rik) NP_001128491 RIKEN cDNA 5730601F06 gene Gene [Source:MGI Symbol;Acc:MGI:1924769]


SPLK-Sequence tag 3SD054C03
Sequence
CCGGGGGNNNNNNNNNNGGCTTATCTAGGGAATCTTTTTATTTTTTCCTTTTCTCTTTCCTCTCTCCCTTTCTTTAAAAA
AATTCTTTTTGTTTTTTGAGATTATAATACAACTCCATTTCGCCCTTCCCTTTCCTCTCTCTGTATCTCTCCCTATATCT
CCTTCCTCTCATGGACCCTCACTTTCTTTCAAGTTCATGGTCTCATTCCATTCATTGTGTGTTTATGTTCCTAAATATAT
AAATATAATCTCCATAGTTCACGTAGTTTTCCTTGTATGTATGTTTTTAAGGCTGACCAGTTGGTATTGGATGACCAGTT
GGCATGCTCTTCCCCTGTGGAGGTTCCCCCCCCCCCCCCAAAAAACCTAATTTGCCAAAAGTCCCCGGGGGGGGGGGGGC
CCCTTTAAATTTCCCTTTCCCCCAATAAAAAGGTTTTTAAGGGCCCCCCTTCCCCCAATAAAAAGGTTAATAAGGGCCCC
CCTGCCCCGCCCCCTTTTTAAGGGGAAATTTTTAGGGGGTTTCGGACTTAAAAAAGAAAAAAAACCCCAAAAAAAACCCC
TGGACCCCCGAATTTAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000060510


For any suggestions or comments, please send an email to unitrap@crg.es