Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D054A12
Clone ID D054A12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD054A12
Sequence
GTATGACTAGCTCATACAGGCTGGAAAAAAAGGATTCTTTTAGGTACTATAAAGGCTCAGCAGACAGAGCAGTTCTTTCT
AGCAGGAGGGATCATAAT
Sequence Type genomic DNA
Unitrap ID UNI15801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107759957..107760054 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]


SPLK-Sequence tag 3SD054A12
Sequence
GTCATGCTTTCTTATTTAAGAGAGGGAGGCCACATGCAAATATATGTGCCACAATCTACATGTAGAGGTCAGTTCTCTCA
CATGCGGGTGCTGG
Sequence Type genomic DNA
Unitrap ID UNI15801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107760083..107760178 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es