Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D053C08
Clone ID D053C08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD053C08
Sequence
ATGTACAGATGTTATTTTGTGCTCAGGGTCTATGAATAATTTCACCCACAGTGACCCACCTCTGGATGAGGGAGCAGAGG
CGGAGAGAAGCTATGGAATGTGGCTTGACTAGATAAGTGGAGAACTGCATTCCAACTGCTCCTGGTTCATTCAGACACAG
ACAGCCCCTCCCTTCTGCCAGGAGCCACCAGATTTTGTGTTCCCATTGTGGGCTGAGCCCTAGGGAGGGGACAGAGTGTC
TGGTGATCTTAACTTCTGACAAGTGCGGACCTGAACACTTCTGCTACACGCAATCCCA
Sequence Type genomic DNA
Unitrap ID UNI30264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125970697..125970994 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001482 (Def8) NM_054046 differentially expressed in FDCP 8 Gene [Source:MGI (curated);Acc:Def8-003]


SPLK-Sequence tag 3SD053C08
Sequence
AGCTCAGGCATGTGGTCGTGACGTAGGACAGGAACTGAAGCTTGAGAGGTACCATCTCCTACTAGAACCCAGTTGCATTG
TTGGGGCCCGGGGAGGGGCCTAGGTCACCCTGCCAATAGCAGGCCAAGGATGGGCCTTGGATTTAACTCCAGAGAATTCC
CTGGTAAACACTGGTTAACGAGGATGGTATTTTTTGGGTGTTTTGTTGTAGGGAACATCTCAAGTAAGGGGACAGGAAGG
AAG
Sequence Type genomic DNA
Unitrap ID UNI30264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125971005..125971248 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001482 (Def8) NM_054046 differentially expressed in FDCP 8 Gene [Source:MGI (curated);Acc:Def8-003]

 
Come back to gene ENSMUSG00000001482


For any suggestions or comments, please send an email to unitrap@crg.es