Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D051F03
Clone ID D051F03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD051F03
Sequence
GATCCTCCTATCTTTGCCCAATTCACTAACTAATAATTGTTAAGATTTTTACCAGAGGGAGATAGTAATCCATTTTTTGG
GAGACTCAAAAAATAAGAAAGGCTATATTTCAGGAAAATGTCTTATTTTCTCTTTGAAATACTTTTTTTTCATAAAATTG
TTTTATGTTAGCTTAAAATAATTTCTATAACCTCTGG
Sequence Type genomic DNA
Unitrap ID UNI30271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107758642..107758838 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032582 (Rbm6) NM_029169 RNA binding motif protein 6 Gene [Source:MGI Symbol;Acc:MGI:1338037]

 
Come back to gene ENSMUSG00000032582


For any suggestions or comments, please send an email to unitrap@crg.es