Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D051D10
Clone ID D051D10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD051D10
Sequence
GATCTTAACTGCTTCCAGGCCTGGAGTAGCACTAGAAGTTGTTAGTTTCCAAGGTCACCACATGAAACTGTGGTTCCAGT
GGCAGGGAAGTAAGAGCATGTGCTTGCCTTGATGTTGGCTAGAGTAGCTGCAGTTCCAGATGCCACCTGAGGGGAGACTT
TCCCAGGGATGATCTGAGCAGTTAAAGAAAAGGTACCTTCAGAATTTAGAGCTGTTCTGATTGATAAGGTAGATCAACCG
ATTAAGAATTATTATGATGCT
Sequence Type genomic DNA
Unitrap ID UNI667

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77387071..77387330 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029247 (Paics) NM_025939 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase Gene [Source:MGI (curated);Acc:Paics-001]


SPLK-Sequence tag 3SD051D10
Sequence
AATTCTGTAGTCAGGTCATCTTTAGAGGTAATTTAATGCCACTTGGATGACTAATGTGCCTTCTACCAATCTAGATAAGT
TGGGGGGGGGGGCCCTGAATCTGAATGAATGGCTTGAGGGTAAAACCCTGATTCTAGCCTATAGGAAAAAAACCTTAATT
TTGTTAACCTTATAAAAAAAAAATGGGGGGGGGCATTTGAGGGCAGGGGTTATTAAAAGGCCAGAGGATAAGACTCCCTG
GGGCTAAACTTAAAAGGGGTTGTGGCCCCCCTGCCCCTGGGGAAAAAACCCAAACTCTGCTCCTTCAGGGAAGAAGAAAG
CACTCTTGACAGGGTTTCTCTGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029247


For any suggestions or comments, please send an email to unitrap@crg.es