Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D051D09
Clone ID D051D09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD051D09
Sequence
AATGTAATTCAGTGACAGTTTTTTCAAGTACATTCAAATAAGCATTTAACTTGACTGATGTTTGAACTGTCAAGGAGAGG
TGTTAAAGAGT
Sequence Type genomic DNA
Unitrap ID UNI14684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32919506..32919596 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es