Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D051D04
Clone ID D051D04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD051D04
Sequence
TAGTAACGACTTTTTAATAATATGCAGTTTTTTTNNNAGAACAATGTTAATTCTTAAAAAGCGGCTGATGGAAGGAACTT
CTTTGTTCTATCTTCTTCAGAATGTTAGAAGTCTTAAGAACTCAGGACAAGCAGCAGACATACATGCAACATGGTGGCTG
GTGAGTTAAAAATCATTCATTCGCCGGAAGTATGTGTGCAGTCCGTTTCCCCCCCCCAACCCCTTGGTAATACTGAAACT
TTACAAATCTTGTCATTCTTTGGTGTTGTCTGCTAGAAGCTGCTACCTACTAGGAAACTGCTGATGAGGGAAACGGTATT
AGTTTGTTCATTGGACAACAGTCCCTAAAATCGAAGTCAGTGGAATATTCATGATTAACATTGCAAAGCATCAGCTAAGA
ACCTAAATGGTTTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD051D04
Sequence
ACTTCTAGTTTTCTGGGATAAGGTGTTATACTT
Sequence Type genomic DNA
Unitrap ID UNI1404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108421585..108421617 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es