Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D051B06
Clone ID D051B06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD051B06
Sequence
CAGGCAGGGAGATGGCGGGCTGTGGCCAGGTACAGACCTGTCAGCTTGATACGCCACGTGGGCTCGCCTTTGTCCGTGGC
CGCAGTGCNTGTCCGGCTCGTGGCAGGGCTGTGCCTTATTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD051B06
Sequence
TAGAGGATGTTTCAGCCATTTCTGAATAATCTTTCCTTCAGACATTCTCCAGCTAGTCTGTGGCTTCTGTCTTTCTCTTT
ATGGGGGGCGCGATTGCCACTTAAGGCCTGCTCTTTGCTCCTATTGACTGCGAGACCCCGTGGTTTGGTATCAAAGATAG
GTGGACTGGCTTACAGACCGGGCAGGCGAGAGGGACAGGAAGTCAGGAACAAAAATGATCATGCAAAGGTTCATGCATGC
CCTAGCTCACATGTGAACCCCAGAAGGTAATTTTGTGGAGCGGGTTCGTGGGACCC
Sequence Type genomic DNA
Unitrap ID UNI15046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93828874..93829169 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037601 (Nme1) NM_008704 non-metastatic cells 1, protein (NM23A) expressed in Gene [Source:MGI (curated);Acc:Nme1-001]

 
Come back to gene ENSMUSG00000037601


For any suggestions or comments, please send an email to unitrap@crg.es