Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D051A05
Clone ID D051A05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD051A05
Sequence
GAGAGGGTCCCTTCTCCCCTAGCCACATCTGGTTCTTGTTAGGGTCTCCCAGGATGCCTANNNNTGAAGGCCCCATTNNC
CGGGGGAGGTGGACAGCAGGATTAGGGGCGATTAGGAGTGCTCCTGGCCAGGGAAGGAGGAGCCCAAGAGGAGGGGCGAG
GATGGTTATAAACAGCAGCCCATGACCGCATCAGCCCATCACTCACCAAAGGTGCCAAGTTCAGTCTCAAAAACCTGCAG
CTTCAGCAGCTGGGGCAGTGTGGGGGTGGGGCTCTAGGCTCTCCTCCTTTCTTCCTCAGAAATCTTTAGCAATGCTGTGG
GGCAGGGACCAGACTAGGGGAAGACACAGAAGCAGCAACTACATCTTTCTCCCTGGGAGCAGATTGACTCGTTTTCCCGT
GTGGCTGTGGAGTGAGGAGTGAAGTTTATGAACAATAGTAGTTCATGG
Sequence Type genomic DNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10305420..10305867 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]


SPLK-Sequence tag 3SD051A05
Sequence
ATTCGTCAAGAGTCTCCATCATTGTCACCAGCATGGGGTGAGTTCAGAAGGACTGCTAGACACTTCTTTATAACCTACCA
TCACCAACAATGTCATTTTCCTCGTACGATGGGTTGGTAGGATTTAGTGACACAGTGTGTGTGAAGTTGACGGGATGCCT
CATATATAGTAAACTGGGTGATGAGTGTGGCACACAGTAGGTCCTCAGTTATTGGG
Sequence Type genomic DNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10305181..10305396 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]

 
Come back to gene ENSMUSG00000036098


For any suggestions or comments, please send an email to unitrap@crg.es