Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D050F07
Clone ID D050F07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD050F07
Sequence
TCCCCACCTTTCCAGGGTGGTGTAGCCCCATTTTAGAAACAACTTAAAAAAGCAGAAAGGCCCCCAGATAGTTGTGGGTT
CTAGAAGCTAGCACTTAAGGTATGAGAGCTCATGTCGGGTCCAGTGTTGTCTGC
Sequence Type genomic DNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109973920..109974053 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]


SPLK-Sequence tag 3SD050F07
Sequence
AAATCACTGTTGGAGGTGGTGACAGGGTTCTGGGG
Sequence Type genomic DNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109974076..109974110 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es