Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D050C03
Clone ID D050C03
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D050C03
Sequence
ACTCNNNNAACGCGGCTGGCTTCACCTTCGACTCGGGACTGGAGATCAGGACGCGCTCGGTGGAACAGACTCTTCTGCCC
CTGGTTTCTCAG
Sequence Type mRNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56877849..56877932 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


SPLK-Sequence tag 5SD050C03
Sequence
CATATGACATTACGTTTATTTCTACATAACAAAATGCCTCAAAACTTAATGGATTAAAATAAGTCAGTTCCTTAGACATT
TAGAACCGGGAATTACTTGGGTGGCTCCAGATATCTTCTCTGTGCTGTCTGGAAACCTGAGAATCTGTAGCTTTTGCAAG
TAGCCTTAGTTCTTCATCATGCCCGTGGTTCTCGTGACCTGGCTTCCCCTAGAGTGAAGGGGTTAGAGATGGAAACCCAG
TGAGACCATGCCTTACCTTCTAGAGGAAGTAACAACACAGTCGCCTCTGCTTTTCTCTATGCCCTGAGAGAGAAGACG
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56867766..56868083 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


SPLK-Sequence tag 3SD050C03
Sequence
GTTCTCTAGCCTCTTCGGTAAATTGTTTCCCTTCCATCCGTAAACAACCTGTCCTGAAAGCATCAGCCTGAATCACAAGG
CTGACCTGGAAATCTGTCTGGCTTTTTGTAGATAGCCATTTCCCAAGCGTAACTCGTTCTAGCTGTAGGAACGTGAGAAC
ATGCAGGATGTTTTGTTTGATGCTTAGACT
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56867367..56867556 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es