Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D050B06
Clone ID D050B06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD050B06
Sequence
GGTCCTTGTTTTCAAATTGGTGGCTGTTGGTAGTTAATTTCCATGGGTCTGTCTGCTCTCACTATGACCTGAAGAACACT
TGACTGTGTTGAGCTGGGACAGAAAGCAGCCAACGTTAAATGTCAGGGTAGCTGGATTGTATGTCCCTGTTAGGGAACGA
TCCACAGATAATAAATAAAGGTAACTGTAGTTTGACAGTCACATAGCCTTAGTGGCCTTGAGAAGAAACAAGGAATTCTC
AAATGAAGCTTCTCAAAGATTCTATCCCAAAGCCTGGTTAGAAGTTTATTAAAACCCCAG
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29689868..29690167 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]


SPLK-Sequence tag 3SD050B06
Sequence
AGTTCTTTCCCCTTGCACTCACTGAATACTCAGCAAGTGGTATAGTTGTCACATTCCTCTGCACGATGCTGGAGTGTCTT
TGATGCCGCCTTTGCTCTGGCTCCTGATCATTGCTGATCTGGGAGGTACCTGCCATTTCTGCTGGTTGATTAGGTGACTC
ATTGACTGATTGACCCAGGAGAGTGCTCTGTGTAGCCCAGGGTGACCCTTTCCTCTTCTGCCCCATCACAGACATAGTCC
ACTCCATAGTCCAGTCCTGTTACAGGGTGGCTGGCTAGCAAGGGAGGGCAGGAGCTGAGCAGCAGTTCCTGGGCATTTTA
AACTGCTTAGCATGCATTTCACAGCCTCTCTGGGGCCAGCTGTTCCTTTCTCTGCTCGCCAGGCCTNGGAGTTGATGACT
TTCCTACCTCCCTCCTCTTCCCCTCCCTTCCCAGTCCCTGTGCAAAATTGCTTTTGAAAAG
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29690716..29691177 442
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es