Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D050A05
Clone ID D050A05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD050A05
Sequence
ACCCCCACTCCCCAACTGCCAGGTGCCAGGGACTTGAAGAAAGGAGTTGCCCACGCTTCACAGCCTCTGAATTATTCTCA
GACTCCCAGGGAAAGCAAAAAGGAGAGTCAGGTTAGTAAGTGCTTACAGAGCCAGGCGTCACTCTTTGTGATTAGGAAGA
TGAACGATCCCTTGCTTTGCTCAGCACTTTGTAGATTTCAGAGTGCTTCCTCAGCCACTGGGTACTGTTGGACCCCCACA
GCCTTCCTGATAAGCAGGCTGGGCAGGAATCACGGTTCTCCTTCCAGGCACCTAGACTTGAGAGAGGCCTGAGCTGCCTT
AGGTTGTTATTTACTAGCAAACAGCAGGAGCCTGGGGGTGAGGGGAAGCACTTGCTCCATGGAGTGCTTGATATGTGTGG
GTGTTTTGTGTTTTGCCTGCATGTATGTTCCAGTACTGGTGTACAGGGAGGACAGAAGAAGAGGTAAG
Sequence Type genomic DNA
Unitrap ID UNI14313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42066685..42067152 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025171 (Ubtd1) NM_145500 ubiquitin domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2385092]

 
Come back to gene ENSMUSG00000025171


For any suggestions or comments, please send an email to unitrap@crg.es