Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D049E02
Clone ID D049E02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D049E02
Sequence
CGATCTTGTCTTGTTCATGAAGAAGTAGAAGCATCGAAAGGTTGGAGAGAATTACAGGAACGGTGGCGACAGCGGTATTT
CGGATTCGGANNGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21775195..21775282 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028248 (Sfrs18) splicing factor, arginine/serine-rich 18 Gene [Source:MGI (curated);Acc:Sfrs18-001]


SPLK-Sequence tag 5SD049E02
Sequence
TCAGGATTTTTTTTCTCCTTGTGTTGGGGGGACATGAGGGTGCTGGGGATCATACATAGCNNTTGCATATGTAAGCCAAG
TTCTCTACTACT
Sequence Type genomic DNA
Unitrap ID UNI29607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21778141..21778232 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028248 (Sfrs18) splicing factor, arginine/serine-rich 18 Gene [Source:MGI (curated);Acc:Sfrs18-001]


SPLK-Sequence tag 3SD049E02
Sequence
TATTAAGATATACTTTTTGTGGCTAAAGTTGCATATTTAGTGGGTAACATATATGAGTGATAAATGAGTAAAATACCTAA
CCATTTAATATAAACACAATACAATGATAGAGCGAGCACTCAGTAAGGTTTCCTCTGTTCATAAGGAAATCTTTGAGCAT
TCAAACATTTATTCTACAAGAACTATTGCATATTAACTTTTAATTTATGGAGATTTTCAGACAGTGTCTGCCTTCAACAG
TTAACGTTTTCCAAATTATTACTCACCCAATATACGACCATAAGTTTTCATGGTTTAAATCCATTATTAAAACTTAGTGG
GTCTGTTGATATAGTTCAGCAGTAGTGCCTTTGCTTATCTCAAGAAACAAAAAAAAGTTGAATTAAAAATTGTGTCTGTG
GAACTGTTCATATTGAACATAGTCATGTTTTCCAAACTAAAAGTCCAAATACAGGACCAAACTCAACAACAAGCTTCAA
Sequence Type genomic DNA
Unitrap ID UNI29607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21778286..21778764 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028248 (Sfrs18) splicing factor, arginine/serine-rich 18 Gene [Source:MGI (curated);Acc:Sfrs18-001]

 
Come back to gene ENSMUSG00000028248


For any suggestions or comments, please send an email to unitrap@crg.es