Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D049C08
Clone ID D049C08
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD049C08
Sequence
GATCCGTATCTTCTCTGATTTCTTGTGTATCTTTGCATCATGTTCTGCAATCAGCTTCTCAACCTTGGCTGGTTTGCTCA
GTCTGTTCCCAAAGTTGACTCTGGAGTCTAGCTCAAGTTTTTTATTTGCAACATTGGTGCTCCTTTTCACCGACTTTGCC
TGCTGCTGTGGTGGCACTAATTCTCCCTGGGTCTTAGGTGGAGAAAATACATACATAGTATCCATTTCCTATTGGAGAGA
TTGCCACTTCATTAAAGATTTCAGCCTGCTTCCTTGTGTTCCTTCTGGGAAGTATCAGCTATCAAGAACCCCGTGCTGTT
GGTTGATTGGTCAATTGGTTGTTTGACTCATTGTTTCTCCAGAGCTTGCCTGATTTCTGTCTTTGCTGATGCTCCTAAGT
TCATGCTGACCATCTATAATAAACT
Sequence Type genomic DNA
Unitrap ID UNI23013

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4076137..4076561 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005981 (Trap1) NM_026508 TNF receptor-associated protein 1 Gene [Source:MGI (curated);Acc:Trap1-001]


SPLK-Sequence tag 3SD049C08
Sequence
ACTAGAAGGCAGACAGGAAGTGGACTCCATGTAACTAGCTCTCACCTGTGTCTTCTGTAAATTGGAGATGGTCTGACATT
TGTAAT
Sequence Type genomic DNA
Unitrap ID UNI23013

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4076032..4076119 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005981 (Trap1) NM_026508 TNF receptor-associated protein 1 Gene [Source:MGI (curated);Acc:Trap1-001]

 
Come back to gene ENSMUSG00000005981


For any suggestions or comments, please send an email to unitrap@crg.es