Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D048H10
Clone ID D048H10
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D048H10
Sequence
GAACTCTTCGGCAGGGCTCTGGCTCTACGGGTTGGCGCGAGAGTCAAAAGGCTCGCATCGCTTTTGCGCAAGATGGCTGC
TGCGGGGGCATTCGCGTACTGAGTGCTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAG
Sequence Type mRNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180444615..180444762 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 5SD048H10
Sequence
GGCCCAGAGAAATTGCTTCACTTGCAGCTCTTGTTAAAGAGTT
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180441495..180441537 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 3SD048H10
Sequence
GAGCTGGGTATGGTGGTGCACTTCTTTAATCCCAATACTTGGNAGGCAGAGCGAGGCGGATTTCTGAGTTCAAGGCCAGC
CTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACTCTGTCTCAAAAAAACAAAAGAAAACAAAAAA
GAGTTTGATCTCCAATCCCAACACATGGTGGCATAATTACTTGTAACTCCAGCTTCAAGGG
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180441267..180441487 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es