Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D048F02
Clone ID D048F02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D048F02
Sequence
CGGGNNNGCGGGTGGGAGAAGGTGAGGGAGCCGCCAGTGGTCCCCGGGAGGCTCGAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD048F02
Sequence
GGCTGAGTAATCCGGTACAGGTCTGGTATTAGACTTCGGCCTAGTAGGTAGCCCAAATAGCAGGGAAAGGTGAAGT
Sequence Type genomic DNA
Unitrap ID UNI6711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50138591..50138666 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]


SPLK-Sequence tag 3SD048F02
Sequence
AAATAACTTGCCCAAAGGAAGACTGGACCATAGCATCCTGATGAGGGAGTAGAATGTACTAGAACGTGTACCGCTTGAGA
AACTTAAGGCTTAACTATTAAAGCACCTGCCTATTCGGTGGTGGATAGATAGTAATCCAGTGTGGGTGTTCACAGGACCC
Sequence Type genomic DNA
Unitrap ID UNI6711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50138402..50138561 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]

 
Come back to gene ENSMUSG00000020368


For any suggestions or comments, please send an email to unitrap@crg.es